Language Post

Part1: This week’s assignment was to engage in a 15 minute conversation without speaking, writing, and using sign language. This assignment was difficult for me at first; my partner and I are usually talking nonstop. So it was a challenge to not talk for 15 minutes. I found my partner and I getting frustrated but saw that my partner made a change in trying to communicate with me.  My partner was trying to be more specific and tried describing things to me without speaking. If my partner and I were from two different cultures I feel like the culture with the speaking skills would hold a higher advantage over the culture without the speaking culture. I feel the culture that does speak would react towards negatively they would feel that the other culture is not to their level and would feel that they are the better race. In everyday life you encounter people that speak different languages I’ve seen people try to communicate with each other through hand gestures and pointing and nodding I feel like that would be the best way to communicate with someone without speaking.

Part2: During this assignment I was not able to sit still while talking I always flail my arms around and have excitement in my voice when I talk. This was very difficult for me because I am so accustomed to using my hands when I describe things or tell stories so it was definitely a challenge to hold my arms down. Also it as difficult to keep the tone of my voice level people are so used to emphasizing the importance of what they are saying that they forget how difficult it is to restrain from doing so. My partner was not used to speaking this way he was also trying very hard to keep his voice level. It was also hard to talk to my partner without using my hands as a visual for better understanding. Most people use hand signals to show how things work when you can’t describe it through your voice. I think that cultures could communicate but it they would have a better understanding by the sound of the speaker’s voice or their hand gestures. The time where it is not essential to use body language is when you are solely focused on someone’s conversation or when you’re talking over the phone.

Piltdown Hoax

·         The Piltdown Hoax rocked the small town in southwest England in the 1900s. In the town of Piltdown a laborer discovered a strange skull at Barkham Manor. The scientific community was affected by it immensely being attacked with questions. This hoax tricked the world for 50 years until uncovering the truth. The skull went under examination and found that the bones were not as old as they assumed the bones were made to look old, also scientists believed that the jaw did not belong to this skull making it difficult to put the pieces together.

·         Other countries around the world had their own discoveries, finding evidence of the early living man. England was disappointed that Germany and France were finding historical artifacts that once the skull was found at Barkham Manor they were ecstatic. Thus the reason the investigation did not go any further.  Jealousy played a big role in this, England decided not to investigate whether the findings were real they believed the findings were true because they wanted to compete with other countries.

·         The hoax was discovered by the research done on the skull. A piece of the jaw bone was broken off making it frustrating to picture the missing piece. The scientists believed that the jaw did not match the skull and felt as if it was placed there. Scientist believed that the only thing missing was a canine tooth and later went back to the Barkham Manor and discovered the canine tooth bringing their investigation together.

·         It would be quite impossible to take the human factors out of scientific discoveries. These discoveries deal with human influences daily it would be difficult to remove human emotions in science. It would be a good idea to remove the human influences from science. Research would be made thoroughly if there was no human factor. The lessons could teach those not to assume something is true you need evidence to prove what is true or not.

Analogy/Homology

1.       Pax6 is a gene that regulates eye development in the embryotic development. This trait also produces large amounts of cortical cells which are beneficial to brain development. Pax6 forms the lens, cornea, and olfactory epithelium. This trait is found in humans and in fruit flies. Aniridia patients revealed that they had intragenetic mutation. These mutations were found by defects of the Pax6 gene. Pax6 also helped development in the nose, eyes, pancreas, and central nervous system in humans. Mutation due to Pax6 results in eye development failure and pancreatic defects. Pax6 can cause a fruit fly to grow an extra eye if this gene is placed directly in the antenna of the fly. This gene has the same structure in both the fly and the human. Studies show that a human and a mouse most recently show a common ancestor. The fruit fly shares a common ancestor with both the mouse and the human but this ancestor existed so long ago it would be hard to pin point a specific ancestor.

2.       Both a fly and a bird possess wings although they function the same. The structure of the wings between a fly and a bird is vastly different. An insect wings is actually formed in a sack during embryotic development and is attached to their back, what strengthens the insects wings are the veins running throughout its wings. A birds wing skeleton has some similarities with a human arm. The bird has a shorter forearm and they possess fingers as well. The bones in the wing are minor compared to the size of the actual wing. It’s hard to say what common ancestor a bird and a fly might possess but I believe if they had one it would be from the megasecoptea group. Although this group is strictly insects fossils have been found with the same shape and structure of a bird wing.

 

DNA to RNA

ACCCUCGACUGUCCCUUGCAGAAUUGCAACAGA

Jean-Baptiste Lamarck

 Jean-Baptiste Lamarck is one of the major influences of Charles Darwin and his theory of evolution although Jean-Baptiste Lamarck's studies never gained the acceptance he deserved, he is now known for his unacknowledged theory of heredity. Lamarck published his book  Philosophie Zoologique where he stated his theory of evolution. Lamarck also separated and classified his work on invertebrates. He  believed that organism changed along with their environment and could acquire desired traits through heredity. But in order to receive those desired traits they were meant to be passed down from generation to generation over the coarse of time. Charles Darwin found Lamarck's study of inheriting desired traits important in the study of evolution. Although Jean couldn't prove his theory of genetics they believed the use and disuse theory was a probable hypothesis in evolution. Lamarck's theory was proven false. Charles Darwin studied Lamarck's previous hypothesis of heredity and proved his theory incorrect and with that he then created his own theory of evolution. The church had a negative affect on Darwin's studies the church felt like they were threatened by the idea of evolution. They publicly argued against Darwin's ideas  Many people believed that "Darwin's ideas destroyed the important distinction between man and beast."

http://www.ucmp.berkeley.edu/history/lamarck.html